Taxonomic assignment report
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-04-03 05:35:43 |
| Analysis completed | 2025-04-03 05:35:43 |
| Wall time | 0:0:0 hours |
Sample details
| locus | ITS |
| preliminary_id | Fungi |
| taxa_of_interest | |
| country | Australia |
| host | Vitis vinifera |
| sample_id | FungusB_ITS |
| Query DNA sequence |
Input DNA sequence
>FungusB_ITS TAGGTGAACCTGCGGAAGGATCATTACCGAGTTGATTCGAGCTCCGGCTCGACTCTCCCA CCCCATGTGTACCTACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCACCGACCCCCGT TCGGGGGCCGGCCAGCGCCCGCCAGAGGACCACAAAACTCCAGTCAGTAAACGTCGCAGT CTGAGAAACAAGTTAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGA TGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA TCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATT TCAACCCTCAAGCTCTGCTTGGTATTGGGCTCCGTCCTCCGCGGACGCGCCTCGAAGACC TCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGAAAACACCTCGCTTTGGAGCGCATGGCG TCGCCCGCCGGACGAACCTTTGAATTTTTCTCAAGGTTGACCTCGGATCAGGTAGGGATA CCCGCTGAACTTAAGCATAT
Result overview
Inconclusive
The analyst should attempt subjective species identification at the genus level.
Reasoning - Flag 1C:
>3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1C) |
|
No taxa of interest provided at rank genus/species
Analyst evaluation
Identification of candidate species
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 500 | 16 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|---|---|---|
| Neofusicoccum australe | 218 | 100.0% | 0.0 |
| Botryosphaeria dothidea | 1 | 100.0% | 0.0 |
| fungal endophyte | 85 | 100.0% | 0.0 |
| Neofusicoccum cryptoaustrale | 12 | 99.8% | 0.0 |
| Neofusicoccum luteum | 148 | 99.8% | 0.0 |
| Neofusicoccum stellenboschiana | 11 | 99.8% | 0.0 |
| Neofusicoccum sp. ALG69 | 1 | 99.8% | 0.0 |
| Neofusicoccum sp. YPZ-2016c | 2 | 99.6% | 0.0 |
| Neofusicoccum rapaneae | 3 | 99.6% | 0.0 |
| Neofusicoccum laricinum | 2 | 99.6% | 0.0 |
BLAST search results
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | HQ392715 | Neofusicoccum australe isolate BB59-3 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 2 | MW289942 | Neofusicoccum australe isolate L6-9.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 3 | MW289952 | Neofusicoccum australe isolate U9-1.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 4 | MW289980 | Neofusicoccum australe isolate U9_2.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 5 | MW045379 | Neofusicoccum australe isolate U9-9.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 6 | MH863758 | Neofusicoccum australe culture CBS:125786 strain CBS 125786 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 7 | KY711220 | Neofusicoccum australe strain CDFA182 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 8 | MW289945 | Neofusicoccum australe isolate L8-8.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 9 | DQ299244 | Botryosphaeria australis strain CBS119046 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 10 | MW289946 | Neofusicoccum australe isolate I9-6.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 11 | MW290010 | Neofusicoccum australe isolate L3-5.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 12 | MW289988 | Neofusicoccum australe isolate U8-5.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 13 | MW289947 | Neofusicoccum australe isolate L6-6.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 14 | KY711218 | Neofusicoccum australe strain CDFA72 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 15 | MG828923 | Neofusicoccum australe strain MFLUCC 17-0772 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 16 | MW045391 | Neofusicoccum australe isolate L2-4.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 17 | MT587467 | Neofusicoccum australe culture CPC:31414 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 18 | MW289970 | Neofusicoccum australe isolate L9-5.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 19 | MW290001 | Neofusicoccum australe isolate L1-3.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 20 | MT587463 | Neofusicoccum australe culture CPC:29004 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 21 | MW289991 | Neofusicoccum australe isolate U8-3.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 22 | KY711219 | Neofusicoccum australe strain CDFA133 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 23 | MW290003 | Neofusicoccum australe isolate L1-2.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 24 | MW289950 | Neofusicoccum australe isolate U5-3.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 25 | KC881084 | Neofusicoccum australe strain ATCC 60344 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 26 | MW289954 | Neofusicoccum australe isolate L3-4.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 27 | MT587466 | Neofusicoccum australe culture CPC:29050 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 28 | MW290007 | Neofusicoccum australe isolate L3-3.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 29 | PQ431426 | Neofusicoccum australe isolate FK-876 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 30 | FJ150696 | Neofusicoccum australe strain CBS 115185 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 31 | MW290025 | Neofusicoccum australe isolate L1-1.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 32 | MW290004 | Neofusicoccum australe isolate L9-1.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 33 | OM415970 | Neofusicoccum australe isolate R5.5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 34 | MW045385 | Neofusicoccum australe isolate L9-6.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 35 | MW045380 | Neofusicoccum australe isolate U7-8.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 36 | KF766200 | Neofusicoccum australe strain CMW 6837 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 37 | MW289997 | Neofusicoccum australe isolate U9-10.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 38 | MW289959 | Neofusicoccum australe isolate L3-7.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 39 | MT416401 | Neofusicoccum australe isolate I5-1.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 40 | MW289958 | Neofusicoccum australe isolate L1-9.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 41 | MW289978 | Neofusicoccum australe isolate U9-10.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 42 | MW290008 | Neofusicoccum australe isolate L9-6.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 43 | JQ694120 | Neofusicoccum australe voucher PDD:95990 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 44 | ON055582 | Neofusicoccum australe strain ICMP 18453 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 45 | MT416402 | Neofusicoccum australe isolate L9-1.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 46 | MT587455 | Neofusicoccum australe culture CBS:113219 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 47 | MT587462 | Neofusicoccum australe culture CPC:28980 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 48 | MW045375 | Neofusicoccum australe isolate I1-7.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 49 | MW045377 | Neofusicoccum australe isolate U9-1.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 50 | MW289955 | Neofusicoccum australe isolate U8-3.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 51 | MT587458 | Neofusicoccum australe culture CBS:130996 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 52 | MW045378 | Neofusicoccum australe isolate L4-1.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 53 | MW289961 | Neofusicoccum australe isolate L9-4.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 54 | FJ150697 | Neofusicoccum australe strain CPC 13783 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 55 | OP563820 | Neofusicoccum australe isolate GJM61 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 56 | MW289943 | Neofusicoccum australe isolate I2-9.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 57 | MW045382 | Neofusicoccum australe isolate L4-5.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 58 | MW289987 | Neofusicoccum australe isolate L2-8.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 59 | MW289951 | Neofusicoccum australe isolate L9-3.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 560.0 | 0.00e+00 | 100.0% |
| 60 | MW045393 | Neofusicoccum australe isolate I7-2.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 559.0 | 0.00e+00 | 100.0% |
| 61 | MT587454 | Neofusicoccum australe culture CBS:113077 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 559.0 | 0.00e+00 | 100.0% |
| 62 | MT587464 | Neofusicoccum australe culture CPC:29026 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 559.0 | 0.00e+00 | 100.0% |
| 63 | MT587469 | Neofusicoccum australe culture CPC:32013 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 559.0 | 0.00e+00 | 100.0% |
| 64 | MW045389 | Neofusicoccum australe isolate L4-7.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 559.0 | 0.00e+00 | 100.0% |
| 65 | MT587461 | Neofusicoccum australe culture CPC:28892 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 559.0 | 0.00e+00 | 100.0% |
| 66 | MT664120 | Neofusicoccum australe isolate L2-9.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 559.0 | 0.00e+00 | 100.0% |
| 67 | MW045386 | Neofusicoccum australe isolate L4-2.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 559.0 | 0.00e+00 | 100.0% |
| 68 | MT587471 | Neofusicoccum australe culture CPC:32259 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 559.0 | 0.00e+00 | 100.0% |
| 69 | MT587465 | Neofusicoccum australe culture CPC:29036 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 558.0 | 0.00e+00 | 100.0% |
| 70 | MT664119 | Neofusicoccum australe isolate U8-5.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 557 | 99.5% | 557.0 | 0.00e+00 | 100.0% |
| 71 | MW045394 | Neofusicoccum australe isolate L10-2.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 557 | 99.5% | 557.0 | 0.00e+00 | 100.0% |
| 72 | MW290002 | Neofusicoccum australe isolate L9-3.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 556 | 99.3% | 556.0 | 0.00e+00 | 100.0% |
| 73 | MT664132 | Neofusicoccum australe isolate L10-8.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 556 | 99.3% | 556.0 | 0.00e+00 | 100.0% |
| 74 | MT664135 | Neofusicoccum australe isolate U5-6.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 555 | 99.1% | 555.0 | 0.00e+00 | 100.0% |
| 75 | MW289935 | Neofusicoccum australe isolate L9-2.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 555 | 99.1% | 555.0 | 0.00e+00 | 100.0% |
| 76 | MW828154 | Botryosphaeria dothidea isolate 014 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 555 | 99.1% | 555.0 | 0.00e+00 | 100.0% |
| 77 | MH057198 | Neofusicoccum australe strain BRIP59728 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 555 | 99.1% | 555.0 | 0.00e+00 | 100.0% |
| 78 | MW289936 | Neofusicoccum australe isolate U6-10.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 555 | 99.1% | 555.0 | 0.00e+00 | 100.0% |
| 79 | MT664136 | Neofusicoccum australe isolate I8-4.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 80 | KP692189 | Neofusicoccum australe isolate 1782 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 81 | MW290005 | Neofusicoccum australe isolate L2-5.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 82 | MT664137 | Neofusicoccum australe isolate L10-4.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 83 | ON571633 | Neofusicoccum australe isolate I4-1.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 84 | MW289962 | Neofusicoccum australe isolate L9-8.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 85 | MW045396 | Neofusicoccum australe isolate I7-5.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 86 | MW045364 | Neofusicoccum australe isolate I9-1.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 87 | MW045390 | Neofusicoccum australe isolate I8-6.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 88 | MT664125 | Neofusicoccum australe isolate U1-4.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 89 | MW045362 | Neofusicoccum australe isolate U1-4.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 90 | MW290034 | Neofusicoccum australe isolate U9-8.2B internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 91 | MT664141 | Neofusicoccum australe isolate I7-10.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 92 | MT664140 | Neofusicoccum australe isolate I8-1.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 93 | MW045395 | Neofusicoccum australe isolate U6-1.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 94 | MW045392 | Neofusicoccum australe isolate I7-2.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 95 | MT664129 | Neofusicoccum australe isolate U2-9.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 96 | MT587473 | Neofusicoccum australe culture CPC:33052 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 97 | MT664126 | Neofusicoccum australe isolate I9-3.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 98 | MH057204 | Neofusicoccum australe strain BRIP65680 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 99 | MW289941 | Neofusicoccum australe isolate L2-3.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 100 | HM176532 | Neofusicoccum australe strain CMW 822 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 101 | MT664124 | Neofusicoccum australe isolate I9-5.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 554.0 | 0.00e+00 | 100.0% |
| 102 | OL871415 | Neofusicoccum australe strain ICMP 15810 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 103 | MF578757 | Neofusicoccum australe isolate PALUC474F internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 104 | MT664122 | Neofusicoccum australe isolate I7-6.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 105 | OL871401 | Neofusicoccum australe strain ICMP 15894 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 106 | MT664123 | Neofusicoccum australe isolate L2-5.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 107 | OL871420 | Neofusicoccum australe strain ICMP 17597 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 108 | MT416400 | Neofusicoccum australe isolate I9-6.2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 109 | MG547966 | Neofusicoccum australe isolate EFA 437 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 110 | MT587468 | Neofusicoccum australe culture CPC:31418 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 111 | OL871435 | Neofusicoccum australe strain ICMP 14371 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 553.0 | 0.00e+00 | 100.0% |
| 112 | KF955691 | Neofusicoccum australe strain 6B39 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 552 | 98.6% | 552.0 | 0.00e+00 | 100.0% |
| 113 | MT587470 | Neofusicoccum australe culture CPC:32017 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 552 | 98.6% | 552.0 | 0.00e+00 | 100.0% |
| 114 | MH057205 | Neofusicoccum australe strain BRIP65681 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 552 | 98.6% | 552.0 | 0.00e+00 | 100.0% |
| 115 | MT664130 | Neofusicoccum australe isolate I8-8.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 551.0 | 0.00e+00 | 100.0% |
| 116 | MF578755 | Neofusicoccum australe isolate PALUC439F internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 551.0 | 0.00e+00 | 100.0% |
| 117 | PQ556069 | Neofusicoccum australe isolate TBC0038.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 551.0 | 0.00e+00 | 100.0% |
| 118 | MF578758 | Neofusicoccum australe isolate PALUC490F internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 551.0 | 0.00e+00 | 100.0% |
| 119 | PQ556068 | Neofusicoccum australe isolate TBC0027.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 551.0 | 0.00e+00 | 100.0% |
| 120 | MH777017 | Neofusicoccum australe isolate F9.2 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 551.0 | 0.00e+00 | 100.0% |
| 121 | MH777013 | Neofusicoccum australe isolate E5.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 550.0 | 0.00e+00 | 100.0% |
| 122 | MW289965 | Neofusicoccum australe isolate U5-2.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 550.0 | 0.00e+00 | 100.0% |
| 123 | MT664127 | Neofusicoccum australe isolate I8-10.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 550.0 | 0.00e+00 | 100.0% |
| 124 | MT664138 | Neofusicoccum australe isolate I5-4.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 550.0 | 0.00e+00 | 100.0% |
| 125 | MW290012 | Neofusicoccum australe isolate I4-3.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 550.0 | 0.00e+00 | 100.0% |
| 126 | MT664128 | Neofusicoccum australe isolate L2-10.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 550.0 | 0.00e+00 | 100.0% |
| 127 | MT664131 | Neofusicoccum australe isolate I5-8.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 550.0 | 0.00e+00 | 100.0% |
| 128 | MW289940 | Neofusicoccum australe isolate L1-5.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 550.0 | 0.00e+00 | 100.0% |
| 129 | MT664133 | Neofusicoccum australe isolate I9_8.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 130 | MT664139 | Neofusicoccum australe isolate U10-3.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 131 | MT664134 | Neofusicoccum australe isolate I5-8.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 132 | MW289971 | Neofusicoccum australe isolate I4-8.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 133 | MW045358 | Neofusicoccum australe isolate U2-10.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 134 | MH777002 | Neofusicoccum australe isolate C1.2 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 135 | MW045373 | Neofusicoccum australe isolate I5-4.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 136 | MT664142 | Neofusicoccum australe isolate I5-10.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 137 | MW045366 | Neofusicoccum australe isolate I8-10.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 138 | MW289972 | Neofusicoccum australe isolate I5-7.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 139 | MT416403 | Neofusicoccum australe isolate I2-6.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 549.0 | 0.00e+00 | 100.0% |
| 140 | MW289995 | Neofusicoccum australe isolate I4-5.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 548 | 97.9% | 548.0 | 0.00e+00 | 100.0% |
| 141 | MW045363 | Neofusicoccum australe isolate U2-3.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 548 | 97.9% | 548.0 | 0.00e+00 | 100.0% |
| 142 | MW290014 | Neofusicoccum australe isolate U2-3.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 545 | 97.3% | 545.0 | 0.00e+00 | 100.0% |
| 143 | MK932725 | Neofusicoccum australe strain CAA838 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 544 | 97.1% | 544.0 | 0.00e+00 | 100.0% |
| 144 | MW290020 | Neofusicoccum australe isolate L8-3.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 544 | 97.1% | 544.0 | 0.00e+00 | 100.0% |
| 145 | MK932744 | Neofusicoccum australe strain CAA841 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 544 | 97.1% | 544.0 | 0.00e+00 | 100.0% |
| 146 | MK932732 | Neofusicoccum australe strain CAA840 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 544 | 97.1% | 544.0 | 0.00e+00 | 100.0% |
| 147 | EU856059 | Neofusicoccum australe isolate B1-05 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 544 | 97.1% | 544.0 | 0.00e+00 | 100.0% |
| 148 | MW289986 | Neofusicoccum australe isolate L8-2.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 544 | 97.1% | 544.0 | 0.00e+00 | 100.0% |
| 149 | MW290027 | Neofusicoccum australe isolate I10-6.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 544 | 97.1% | 544.0 | 0.00e+00 | 100.0% |
| 150 | MK932731 | Neofusicoccum australe strain CAA839 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 544 | 97.1% | 544.0 | 0.00e+00 | 100.0% |
| 151 | OP142416 | Neofusicoccum australe strain SS2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 544 | 97.1% | 544.0 | 0.00e+00 | 100.0% |
| 152 | OM975533 | Fungal endophyte isolate EUSF01086 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 540 | 96.4% | 540.0 | 0.00e+00 | 100.0% |
| 153 | OM975630 | Fungal endophyte isolate EUSF00558 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 154 | OM975623 | Fungal endophyte isolate EUSF00587 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 155 | OM975177 | Fungal endophyte isolate EUSF00942 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 156 | OP142414 | Neofusicoccum australe strain SS1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 157 | OM974927 | Fungal endophyte isolate EUSF01258 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 158 | OM975441 | Fungal endophyte isolate EUSF00579 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 159 | OM974919 | Fungal endophyte isolate EUSF01270 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 160 | OM975516 | Fungal endophyte isolate EUSF01361 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 161 | OM974796 | Fungal endophyte isolate EUSF01719 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 162 | OM975486 | Fungal endophyte isolate EUSF00517 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 163 | OM974912 | Fungal endophyte isolate EUSF01307 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 164 | OM975625 | Fungal endophyte isolate EUSF00582 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 165 | OM975621 | Fungal endophyte isolate EUSF00593 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 166 | OM974849 | Fungal endophyte isolate EUSF01603 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 167 | OM974944 | Fungal endophyte isolate EUSF01239 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 168 | MH777004 | Neofusicoccum australe isolate C4.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 169 | OM975173 | Fungal endophyte isolate EUSF00950 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 170 | OM975495 | Fungal endophyte isolate EUSF01692 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 171 | OM975545 | Fungal endophyte isolate EUSF01032 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 172 | OM974993 | Fungal endophyte isolate EUSF01181 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 173 | OM974908 | Fungal endophyte isolate EUSF01350 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 174 | OM974917 | Fungal endophyte isolate EUSF01272 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 175 | OM975622 | Fungal endophyte isolate EUSF00588 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 176 | OM975560 | Fungal endophyte isolate EUSF00945 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 177 | OM975433 | Fungal endophyte isolate EUSF00592 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 178 | OM974950 | Fungal endophyte isolate EUSF01230 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 179 | MH777006 | Neofusicoccum australe isolate D6.1B 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 180 | OM974924 | Fungal endophyte isolate EUSF01261 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 181 | OM975629 | Fungal endophyte isolate EUSF00560 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 182 | OM975633 | Fungal endophyte isolate EUSF00547 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 183 | OM975557 | Fungal endophyte isolate EUSF00955 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 184 | OM975435 | Fungal endophyte isolate EUSF00590 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 185 | OM975637 | Fungal endophyte isolate EUSF00518 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 186 | OP788200 | Neofusicoccum australe isolate B018 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 187 | OM975627 | Fungal endophyte isolate EUSF00578 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 188 | OM975457 | Fungal endophyte isolate EUSF00555 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 189 | EF445355 | Neofusicoccum australe strain STE-U 5807 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 190 | OM975522 | Fungal endophyte isolate EUSF01231 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 191 | OM974939 | Fungal endophyte isolate EUSF01246 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 192 | OM975626 | Fungal endophyte isolate EUSF00581 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 193 | OM975432 | Fungal endophyte isolate EUSF00594 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 194 | OM975550 | Fungal endophyte isolate EUSF00975 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 195 | OM975334 | Fungal endophyte isolate EUSF00717 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 196 | OM975437 | Fungal endophyte isolate EUSF00586 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 539 | 96.3% | 539.0 | 0.00e+00 | 100.0% |
| 197 | MW290018 | Neofusicoccum australe isolate L4-10.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 558.0 | 0.00e+00 | 99.8% |
| 198 | GQ857659 | Neofusicoccum australe strain UCR509 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 199 | OP654509 | Neofusicoccum cryptoaustrale isolate AVORAM2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 200 | MT738203 | Neofusicoccum australe isolate CT1-011A small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 201 | MW290011 | Neofusicoccum australe isolate I4-7.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 202 | HQ392721 | Neofusicoccum luteum isolate HH197-1 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 203 | MT587520 | Neofusicoccum stellenboschiana culture CBS:139666 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 204 | OP654511 | Neofusicoccum cryptoaustrale isolate AVORAM4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 205 | PP703105 | Neofusicoccum australe isolate BMAE229IB small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 206 | OR960518 | Neofusicoccum australe strain UMAF A1917 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 207 | EF638770 | Neofusicoccum australe strain CAP162 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 208 | MT790248 | Neofusicoccum australe strain RGM_3019 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 209 | OR964263 | Neofusicoccum australe strain UMAF A19108 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 210 | OR964279 | Neofusicoccum australe strain UMAF A19124 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 211 | OP654512 | Neofusicoccum cryptoaustrale isolate AVORAM5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 212 | MW132040 | Neofusicoccum luteum strain 19LSAS010 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 213 | OP654508 | Neofusicoccum cryptoaustrale isolate AVORAM1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 214 | OR963367 | Neofusicoccum australe strain UMAF A1935 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 215 | OR960514 | Neofusicoccum australe strain UMAF A1913 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 216 | MT587521 | Neofusicoccum stellenboschiana culture CBS:189.28 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 217 | OP654510 | Neofusicoccum cryptoaustrale isolate AVORAM3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 218 | KF702388 | Neofusicoccum australe strain E54ML 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 219 | KJ657714 | Neofusicoccum sp. ALG69 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 220 | MT107904 | Neofusicoccum australe strain ICMP 21498 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 221 | OR964280 | Neofusicoccum australe strain UMAF A19125 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 557.0 | 0.00e+00 | 99.8% |
| 222 | MT587522 | Neofusicoccum stellenboschiana culture CPC:28950 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 556.0 | 0.00e+00 | 99.8% |
| 223 | MT587456 | Neofusicoccum australe culture CBS:113521 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 556.0 | 0.00e+00 | 99.8% |
| 224 | PQ556070 | Neofusicoccum australe isolate TBC0265.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 555.0 | 0.00e+00 | 99.8% |
| 225 | MT587523 | Neofusicoccum stellenboschiana culture CPC:29767 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 555.0 | 0.00e+00 | 99.8% |
| 226 | OR963378 | Neofusicoccum australe strain UMAF A1946 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 555.0 | 0.00e+00 | 99.8% |
| 227 | MH057200 | Neofusicoccum cryptoaustrale strain BRIP63679 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 557 | 99.5% | 554.0 | 0.00e+00 | 99.8% |
| 228 | OR963380 | Neofusicoccum australe strain UMAF A1948 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 554.0 | 0.00e+00 | 99.8% |
| 229 | KY053000 | Neofusicoccum cryptoaustrale isolate PED04 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 555 | 99.1% | 552.0 | 0.00e+00 | 99.8% |
| 230 | OP893662 | Neofusicoccum stellenboschiana isolate CREA-DC TPR OL.60 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 551.0 | 0.00e+00 | 99.8% |
| 231 | OP893663 | Neofusicoccum stellenboschiana isolate CREA-DC TPR OL.431 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 551.0 | 0.00e+00 | 99.8% |
| 232 | OP893664 | Neofusicoccum stellenboschiana isolate CREA-DC TPR OL.438 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 551.0 | 0.00e+00 | 99.8% |
| 233 | OP893665 | Neofusicoccum stellenboschiana isolate CREA-DC TPR OL.453 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 551.0 | 0.00e+00 | 99.8% |
| 234 | KY053041 | Neofusicoccum cryptoaustrale isolate PEL01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 553 | 98.8% | 550.0 | 0.00e+00 | 99.8% |
| 235 | OR963561 | Neofusicoccum australe strain UMAF A1951 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 550.0 | 0.00e+00 | 99.8% |
| 236 | KY053019 | Neofusicoccum cryptoaustrale isolate EL14 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 553 | 98.8% | 550.0 | 0.00e+00 | 99.8% |
| 237 | MF578756 | Neofusicoccum australe isolate PALUC454F internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 550.0 | 0.00e+00 | 99.8% |
| 238 | MH777011 | Neofusicoccum australe isolate E3.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 549.0 | 0.00e+00 | 99.8% |
| 239 | OR964264 | Neofusicoccum australe strain UMAF A19109 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 552 | 98.6% | 549.0 | 0.00e+00 | 99.8% |
| 240 | MH777001 | Neofusicoccum australe isolate B8.1A 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 547.0 | 0.00e+00 | 99.8% |
| 241 | MW289939 | Neofusicoccum australe isolate U2-9.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 547.0 | 0.00e+00 | 99.8% |
| 242 | PQ008478 | Neofusicoccum cryptoaustrale isolate 061-1b internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 547.0 | 0.00e+00 | 99.8% |
| 243 | KU997391 | Neofusicoccum australe isolate CMW25211 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 560 | 100.0% | 554.0 | 0.00e+00 | 99.6% |
| 244 | MW810288 | Neofusicoccum sp. YPZ-2016c strain MAFF 410183 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 554.0 | 0.00e+00 | 99.6% |
| 245 | MW810289 | Neofusicoccum sp. YPZ-2016c strain MAFF 410188 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 554.0 | 0.00e+00 | 99.6% |
| 246 | OR964395 | Neofusicoccum australe strain UMAF A19126 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 554.0 | 0.00e+00 | 99.6% |
| 247 | MT587518 | Neofusicoccum stellenboschiana culture CBS:110866 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 554.0 | 0.00e+00 | 99.6% |
| 248 | OM415956 | Neofusicoccum australe isolate R2.11 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 554.0 | 0.00e+00 | 99.6% |
| 249 | MT587519 | Neofusicoccum stellenboschiana culture CBS:133326 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 554.0 | 0.00e+00 | 99.6% |
| 250 | OR963965 | Neofusicoccum australe strain UMAF A1994 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 554.0 | 0.00e+00 | 99.6% |
| 251 | MT587513 | Neofusicoccum rapaneae culture CPC:35288 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 554.0 | 0.00e+00 | 99.6% |
| 252 | MT587511 | Neofusicoccum rapaneae culture CBS:145973 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 553.0 | 0.00e+00 | 99.6% |
| 253 | OR963950 | Neofusicoccum australe strain UMAF A1979 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 553.0 | 0.00e+00 | 99.6% |
| 254 | OR963957 | Neofusicoccum australe strain UMAF A1986 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 551.0 | 0.00e+00 | 99.6% |
| 255 | OR960524 | Neofusicoccum australe strain UMAF A1923 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 551.0 | 0.00e+00 | 99.6% |
| 256 | OR963363 | Neofusicoccum australe strain UMAF A1931 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 551.0 | 0.00e+00 | 99.6% |
| 257 | MZ048750 | Neofusicoccum cryptoaustrale isolate Nc.LIB07 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 555 | 99.1% | 550.0 | 0.00e+00 | 99.6% |
| 258 | MH183377 | Neofusicoccum australe strain VPRI42863 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 557 | 99.5% | 550.0 | 0.00e+00 | 99.6% |
| 259 | MZ048751 | Neofusicoccum cryptoaustrale isolate Nc.LIB09 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 555 | 99.1% | 550.0 | 0.00e+00 | 99.6% |
| 260 | MT587512 | Neofusicoccum rapaneae culture CPC:32578 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 556 | 99.3% | 550.0 | 0.00e+00 | 99.6% |
| 261 | JX515718 | Neofusicoccum luteum strain UCD360-Oe 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 554 | 98.9% | 548.0 | 0.00e+00 | 99.6% |
| 262 | MH777015 | Neofusicoccum australe isolate F6.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 547.0 | 0.00e+00 | 99.6% |
| 263 | MH777014 | Neofusicoccum australe isolate F3.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 547.0 | 0.00e+00 | 99.6% |
| 264 | MH776999 | Neofusicoccum australe isolate B4.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 547.0 | 0.00e+00 | 99.6% |
| 265 | AB041245 | Guignardia laricina genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, strain:IFO 7888 | 552 | 98.6% | 546.0 | 0.00e+00 | 99.6% |
| 266 | AB454293 | Botryosphaeria laricina genes for ITS1, 5.8S rRNA, ITS2 and 28S rRNA, partial and complete sequence, isolate: MUCC0074 | 551 | 98.4% | 545.0 | 0.00e+00 | 99.6% |
| 267 | MH776991 | Neofusicoccum australe isolate A1.2 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 545.0 | 0.00e+00 | 99.6% |
| 268 | OP861695 | Neofusicoccum australe isolate PCR10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 552 | 98.6% | 545.0 | 0.00e+00 | 99.6% |
| 269 | MH777005 | Neofusicoccum australe isolate D1.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 544.0 | 0.00e+00 | 99.6% |
| 270 | OM975126 | Fungal endophyte isolate EUSF01013 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 543.0 | 0.00e+00 | 99.6% |
| 271 | MW290021 | Neofusicoccum australe isolate I9-8.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 543.0 | 0.00e+00 | 99.6% |
| 272 | PP387616 | Neofusicoccum stellenboschiana isolate UCD10840 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 547 | 97.7% | 541.0 | 0.00e+00 | 99.6% |
| 273 | OM415967 | Neofusicoccum australe isolate R4.20 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 552.0 | 0.00e+00 | 99.5% |
| 274 | GQ857662 | Neofusicoccum australe strain UCR739 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 552.0 | 0.00e+00 | 99.5% |
| 275 | OR963375 | Neofusicoccum australe strain UMAF A1943 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 551.0 | 0.00e+00 | 99.5% |
| 276 | OR781419 | Neofusicoccum australe isolate 160_ITS1F small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 550.0 | 0.00e+00 | 99.5% |
| 277 | MT587453 | Neofusicoccum australe culture CBS:110851 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 549.0 | 0.00e+00 | 99.5% |
| 278 | OR960502 | Neofusicoccum australe strain UMAF A1901 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 549.0 | 0.00e+00 | 99.5% |
| 279 | OR963576 | Neofusicoccum australe strain UMAF A1966 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 548.0 | 0.00e+00 | 99.5% |
| 280 | KF128799 | Neofusicoccum sp. GS4_1_4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 557 | 99.5% | 547.0 | 0.00e+00 | 99.5% |
| 281 | MH777008 | Neofusicoccum australe isolate D8.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 545.0 | 0.00e+00 | 99.5% |
| 282 | KF128800 | Neofusicoccum sp. GS4_1_6 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 554 | 98.9% | 545.0 | 0.00e+00 | 99.5% |
| 283 | MH777012 | Neofusicoccum australe isolate E4.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 545.0 | 0.00e+00 | 99.5% |
| 284 | DQ008323 | Botryosphaeria australis strain UCD1314So internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 554 | 98.9% | 544.0 | 0.00e+00 | 99.5% |
| 285 | MH777009 | Neofusicoccum australe isolate D10.2 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 543.0 | 0.00e+00 | 99.5% |
| 286 | MH777010 | Neofusicoccum australe isolate E1.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 543.0 | 0.00e+00 | 99.5% |
| 287 | MH776993 | Neofusicoccum australe isolate A10.1 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 543.0 | 0.00e+00 | 99.5% |
| 288 | MH777007 | Neofusicoccum australe isolate D7.2 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 543.0 | 0.00e+00 | 99.5% |
| 289 | OM974798 | Fungal endophyte isolate EUSF01717 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 542.0 | 0.00e+00 | 99.5% |
| 290 | OM975062 | Fungal endophyte isolate EUSF01101 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 541.0 | 0.00e+00 | 99.5% |
| 291 | OM975301 | Fungal endophyte isolate EUSF00770 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 541.0 | 0.00e+00 | 99.5% |
| 292 | OM975115 | Fungal endophyte isolate EUSF01030 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 293 | OM975160 | Fungal endophyte isolate EUSF00969 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 294 | OM975488 | Fungal endophyte isolate EUSF00515 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 295 | OM974937 | Fungal endophyte isolate EUSF01248 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 296 | OM975293 | Fungal endophyte isolate EUSF00787 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 297 | OM974829 | Fungal endophyte isolate EUSF01627 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 298 | OM974915 | Fungal endophyte isolate EUSF01274 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 299 | OM974928 | Fungal endophyte isolate EUSF01257 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 300 | OM974905 | Fungal endophyte isolate EUSF01378 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 301 | OM974925 | Fungal endophyte isolate EUSF01260 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 302 | OM975455 | Fungal endophyte isolate EUSF00559 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 303 | OM975070 | Fungal endophyte isolate EUSF01093 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 304 | OM974949 | Fungal endophyte isolate EUSF01233 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 305 | OM974911 | Fungal endophyte isolate EUSF01328 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 306 | OM975216 | Fungal endophyte isolate EUSF00886 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 307 | OM975314 | Fungal endophyte isolate EUSF00749 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 308 | OM975171 | Fungal endophyte isolate EUSF00952 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 309 | OM974885 | Fungal endophyte isolate EUSF01520 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 310 | OM974941 | Fungal endophyte isolate EUSF01244 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 311 | OM975069 | Fungal endophyte isolate EUSF01094 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 312 | OM974933 | Fungal endophyte isolate EUSF01252 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 313 | OM975337 | Fungal endophyte isolate EUSF00713 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 314 | OM974940 | Fungal endophyte isolate EUSF01245 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 315 | OM974947 | Fungal endophyte isolate EUSF01235 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 316 | OM975341 | Fungal endophyte isolate EUSF00709 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 317 | OM975157 | Fungal endophyte isolate EUSF00972 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 318 | OM975371 | Fungal endophyte isolate EUSF00672 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 319 | OM974929 | Fungal endophyte isolate EUSF01256 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 320 | OM974922 | Fungal endophyte isolate EUSF01263 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 321 | OM975345 | Fungal endophyte isolate EUSF00704 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 322 | OM975481 | Fungal endophyte isolate EUSF00523 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 323 | OM975333 | Fungal endophyte isolate EUSF00719 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 324 | OM974795 | Fungal endophyte isolate EUSF01720 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 325 | OM975450 | Fungal endophyte isolate EUSF00565 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 326 | OM974824 | Fungal endophyte isolate EUSF01681 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 327 | OM975365 | Fungal endophyte isolate EUSF00679 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 328 | OM975448 | Fungal endophyte isolate EUSF00567 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 329 | OM974945 | Fungal endophyte isolate EUSF01238 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 330 | OM974918 | Fungal endophyte isolate EUSF01271 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 331 | OM975451 | Fungal endophyte isolate EUSF00564 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 332 | OM975121 | Fungal endophyte isolate EUSF01023 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 549 | 98.0% | 540.0 | 0.00e+00 | 99.5% |
| 333 | OP861690 | Neofusicoccum australe isolate PCR12 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 550.0 | 0.00e+00 | 99.3% |
| 334 | OP861691 | Neofusicoccum australe isolate MUNGV1_3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 549.0 | 0.00e+00 | 99.3% |
| 335 | OR964271 | Neofusicoccum luteum strain UMAF A19116 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 336 | KF766204 | Neofusicoccum parvum strain CMW 9081 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 337 | OR963964 | Neofusicoccum luteum strain UMAF A1993 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 338 | PQ425210 | Neofusicoccum luteum isolate FK-803 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 339 | OR964274 | Neofusicoccum luteum strain UMAF A19119 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 340 | MW132033 | Neofusicoccum luteum strain 19LSAS003 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 341 | KY436374 | Neofusicoccum luteum isolate Nl37 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 342 | PQ556080 | Neofusicoccum luteum isolate TBC0254.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 343 | PQ425218 | Neofusicoccum luteum isolate FK-877 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 344 | MW132035 | Neofusicoccum luteum strain 19LSAS005 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 345 | OP654503 | Neofusicoccum luteum isolate AVF3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 346 | MH183383 | Neofusicoccum luteum strain VPRI20602 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 347 | MW045383 | Neofusicoccum parvum isolate U9-4.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 348 | PQ425178 | Neofusicoccum luteum isolate FK-118_ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 349 | PQ425213 | Neofusicoccum luteum isolate FK-817 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 350 | AY259091 | Botryosphaeria lutea strain CBS110299 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 351 | OR963968 | Neofusicoccum luteum strain UMAF A1997 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 352 | OR964261 | Neofusicoccum luteum strain UMAF A19106 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 353 | PQ425172 | Neofusicoccum luteum isolate FK-34 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 354 | OR960511 | Neofusicoccum luteum strain UMAF A1910 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 355 | PQ425202 | Neofusicoccum luteum isolate FK-712 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 356 | MW132031 | Neofusicoccum luteum strain 19LSAS001 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 357 | MH057191 | Neofusicoccum luteum strain BRIP5016 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 358 | MW132025 | Neofusicoccum luteum strain 19LRHA009 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 359 | PQ425173 | Neofusicoccum luteum isolate FK-35 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 360 | JF271764 | Neofusicoccum luteum strain UCR1180 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 361 | PQ425190 | Neofusicoccum luteum isolate FK-256__ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 362 | PQ425179 | Neofusicoccum luteum isolate FK-119__ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 363 | OR964256 | Neofusicoccum luteum strain UMAF A19101 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 364 | JX869036 | Neofusicoccum luteum isolate UCR1275 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 365 | JF921868 | Neofusicoccum luteum isolate UCR1191 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 366 | PQ425184 | Neofusicoccum luteum isolate FK-185__ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 367 | MT587489 | Neofusicoccum luteum culture CPC:35429 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 368 | PQ571644 | Neofusicoccum luteum isolate FK-768 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 369 | OR964262 | Neofusicoccum luteum strain UMAF A19107 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 370 | OP654506 | Neofusicoccum luteum isolate AVF7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 371 | MT587481 | Neofusicoccum lumnitzerae culture CBS:139676 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 372 | OP654505 | Neofusicoccum luteum isolate AVF6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 373 | PQ425191 | Neofusicoccum luteum isolate FK-257__ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 374 | MW289953 | Neofusicoccum luteum isolate L2-3.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 375 | MW132021 | Neofusicoccum luteum strain 19LRHA005 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 376 | OP654504 | Neofusicoccum luteum isolate AVF5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 377 | PQ425217 | Neofusicoccum luteum isolate FK-860 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 378 | OR963960 | Neofusicoccum luteum strain UMAF A1989 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 379 | JN543668 | Neofusicoccum luteum strain UCR1565 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 380 | MT587485 | Neofusicoccum luteum culture CPC:32247 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 381 | MW289993 | Neofusicoccum luteum isolate U7-8.1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 382 | MT587480 | Neofusicoccum lumnitzerae culture CBS:139675 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 383 | PQ425212 | Neofusicoccum luteum isolate FK-816 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 384 | OR964260 | Neofusicoccum luteum strain UMAF A19105 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 385 | MW132037 | Neofusicoccum luteum strain 19LSAS007 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 386 | PQ425211 | Neofusicoccum luteum isolate FK-814 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 387 | PQ425188 | Neofusicoccum luteum isolate FK-254 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 388 | PQ425181 | Neofusicoccum luteum isolate FK-121_ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 389 | PQ425198 | Neofusicoccum luteum isolate FK-680_ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 390 | PQ425205 | Neofusicoccum luteum isolate FK-743 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 391 | ON055579 | Neofusicoccum australe strain ICMP 18452 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 392 | OR964266 | Neofusicoccum luteum strain UMAF A19111 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 393 | OR963969 | Neofusicoccum luteum strain UMAF A1998 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 394 | JX869032 | Neofusicoccum luteum isolate UCR1359 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 395 | MH183385 | Neofusicoccum luteum strain VPRI42951 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 396 | PQ425180 | Neofusicoccum luteum isolate FK-120__ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 397 | JX869035 | Neofusicoccum luteum isolate UCR1273 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 398 | PQ425175 | Neofusicoccum luteum isolate FK-71_ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 399 | MG978121 | Neofusicoccum luteum isolate 2018 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 400 | OR960505 | Neofusicoccum luteum strain UMAF A1904 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 401 | PQ425220 | Neofusicoccum luteum isolate FK-879 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 402 | OL376284 | Neofusicoccum parvum isolate 7b small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 403 | MT587482 | Neofusicoccum luteum culture CBS:110862 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 404 | OR960509 | Neofusicoccum luteum strain UMAF A1908 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 405 | PQ425199 | Neofusicoccum luteum isolate FK-705__ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 406 | PQ425174 | Neofusicoccum luteum isolate FK-54_ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 407 | MT587487 | Neofusicoccum luteum culture CPC:32388 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 408 | PQ425216 | Neofusicoccum luteum isolate FK-848_ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 409 | PQ425215 | Neofusicoccum luteum isolate FK-822 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 410 | PQ425189 | Neofusicoccum luteum isolate FK-255_ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 411 | MT520629 | Neofusicoccum luteum strain 18ASMA009 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 412 | OP654507 | Neofusicoccum luteum isolate AVF8 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 413 | MW132032 | Neofusicoccum luteum strain 19LSAS002 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 414 | MW131995 | Neofusicoccum luteum strain 19LATH004 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 415 | OL376283 | Neofusicoccum parvum isolate 7a small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 416 | OR960516 | Neofusicoccum luteum strain UMAF A1915 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 417 | KU900316 | Neofusicoccum luteum isolate IT_2421-2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 418 | KY711214 | Neofusicoccum luteum strain CDFA85 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 419 | PQ425176 | Neofusicoccum luteum isolate FK-72_ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 420 | PQ425187 | Neofusicoccum luteum isolate FK-253_ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 421 | MW132039 | Neofusicoccum luteum strain 19LSAS009 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 548.0 | 0.00e+00 | 99.3% |
| 422 | MH057194 | Neofusicoccum luteum strain BRIP54746 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 547.0 | 0.00e+00 | 99.3% |
| 423 | KM870228 | Neofusicoccum australe isolate 1559 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 547.0 | 0.00e+00 | 99.3% |
| 424 | JX869034 | Neofusicoccum luteum isolate UCR1214 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 559 | 99.8% | 547.0 | 0.00e+00 | 99.3% |
| 425 | MH183384 | Neofusicoccum luteum strain VPRI41818 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 546.0 | 0.00e+00 | 99.3% |
| 426 | OR963567 | Neofusicoccum luteum strain UMAF A1957 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 546.0 | 0.00e+00 | 99.3% |
| 427 | OR963379 | Neofusicoccum luteum strain UMAF A1947 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 546.0 | 0.00e+00 | 99.3% |
| 428 | MT587486 | Neofusicoccum luteum culture CPC:32279 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 546.0 | 0.00e+00 | 99.3% |
| 429 | OR960506 | Neofusicoccum australe strain UMAF A1905 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 546.0 | 0.00e+00 | 99.3% |
| 430 | PP701999 | Neofusicoccum sp. isolate W1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 546.0 | 0.00e+00 | 99.3% |
| 431 | JX869033 | Neofusicoccum luteum isolate UCR1211 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 557 | 99.5% | 545.0 | 0.00e+00 | 99.3% |
| 432 | MT587484 | Neofusicoccum luteum culture CPC:32245 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 557 | 99.5% | 545.0 | 0.00e+00 | 99.3% |
| 433 | PQ556078 | Neofusicoccum luteum isolate TBC0116.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 555 | 99.1% | 543.0 | 0.00e+00 | 99.3% |
| 434 | KY053005 | Neofusicoccum luteum isolate PED10 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 555 | 99.1% | 543.0 | 0.00e+00 | 99.3% |
| 435 | DQ233604 | Botryosphaeria lutea strain UCD2057Te 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 554 | 98.9% | 542.0 | 0.00e+00 | 99.3% |
| 436 | PQ556081 | Neofusicoccum luteum isolate TBC0261.2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 542.0 | 0.00e+00 | 99.3% |
| 437 | HQ392717 | Neofusicoccum luteum isolate HH119-1 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 554 | 98.9% | 542.0 | 0.00e+00 | 99.3% |
| 438 | OQ852465 | Neofusicoccum luteum isolate A1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 554 | 98.9% | 542.0 | 0.00e+00 | 99.3% |
| 439 | OL871411 | Neofusicoccum luteum strain ICMP 7010 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 440 | OL871403 | Neofusicoccum luteum strain ICMP 8007 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 441 | OL871427 | Neofusicoccum luteum strain ICMP 7813 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 442 | OL871404 | Neofusicoccum luteum strain ICMP 8008 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 443 | OL871364 | Neofusicoccum luteum strain ICMP 8010 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 444 | OL871419 | Neofusicoccum luteum strain ICMP 15108 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 445 | OL871442 | Neofusicoccum luteum strain ICMP 14095 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 446 | OL871413 | Neofusicoccum luteum strain ICMP 10317 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 447 | OL871377 | Neofusicoccum luteum strain ICMP 8835 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 448 | OL871386 | Neofusicoccum luteum strain ICMP 8006 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 449 | OL871408 | Neofusicoccum luteum strain ICMP 7007 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 450 | KY053017 | Neofusicoccum luteum isolate EL11 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 451 | OL871441 | Neofusicoccum luteum strain ICMP 16678 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 452 | OL871431 | Neofusicoccum luteum strain ICMP 17508 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 453 | OL871385 | Neofusicoccum luteum strain ICMP 8005 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 454 | OL871425 | Neofusicoccum luteum strain ICMP 7928 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 455 | OL871421 | Neofusicoccum luteum strain ICMP 7926 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 456 | OL871384 | Neofusicoccum luteum strain ICMP 8004 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 457 | MF967208 | Neofusicoccum australe isolate DGGE gel internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 458 | OL871394 | Neofusicoccum luteum strain ICMP 10300 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 459 | OL871390 | Neofusicoccum luteum strain ICMP 16595 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 460 | MG547970 | Neofusicoccum luteum isolate EFA 469 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 461 | OL871423 | Neofusicoccum luteum strain ICMP 7927 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 462 | OL871434 | Neofusicoccum luteum strain ICMP 17696 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 463 | OL871438 | Neofusicoccum luteum strain ICMP 14198 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 464 | OL871376 | Neofusicoccum luteum strain ICMP 8834 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 465 | OL871388 | Neofusicoccum luteum strain ICMP 11856 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 466 | OL871407 | Neofusicoccum luteum strain ICMP 7006 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 467 | OR963573 | Neofusicoccum luteum strain UMAF A1963 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 468 | HQ392719 | Neofusicoccum luteum isolate BB175-2 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 553 | 98.8% | 541.0 | 0.00e+00 | 99.3% |
| 469 | PQ556079 | Neofusicoccum luteum isolate TBC0212.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 552 | 98.6% | 540.0 | 0.00e+00 | 99.3% |
| 470 | OR963565 | Neofusicoccum luteum strain UMAF A1955 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 552 | 98.6% | 540.0 | 0.00e+00 | 99.3% |
| 471 | OR963575 | Neofusicoccum luteum strain UMAF A1965 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 552 | 98.6% | 540.0 | 0.00e+00 | 99.3% |
| 472 | HQ392720 | Neofusicoccum luteum isolate BB192-1 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 552 | 98.6% | 540.0 | 0.00e+00 | 99.3% |
| 473 | PQ556075 | Neofusicoccum luteum isolate TBC0159.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 539.0 | 0.00e+00 | 99.3% |
| 474 | PQ556074 | Neofusicoccum luteum isolate TBC0037.5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 551 | 98.4% | 539.0 | 0.00e+00 | 99.3% |
| 475 | PQ556072 | Neofusicoccum luteum isolate TBC0034.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 550 | 98.2% | 538.0 | 0.00e+00 | 99.3% |
| 476 | OR963377 | Neofusicoccum luteum strain UMAF A1945 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 546.0 | 0.00e+00 | 99.1% |
| 477 | GQ857658 | Botryosphaeria lutea strain UCR211 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 546.0 | 0.00e+00 | 99.1% |
| 478 | OR960520 | Neofusicoccum luteum strain UMAF A1919 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 545.0 | 0.00e+00 | 99.1% |
| 479 | KX505911 | Neofusicoccum luteum strain CAA628 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 545.0 | 0.00e+00 | 99.1% |
| 480 | MT587496 | Neofusicoccum mangroviorum culture CPC:32647 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 545.0 | 0.00e+00 | 99.1% |
| 481 | MH183316 | Neofusicoccum mangroviorum strain BRIP65980 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 544.0 | 0.00e+00 | 99.1% |
| 482 | MT587495 | Neofusicoccum mangroviorum culture CPC:32580 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 544.0 | 0.00e+00 | 99.1% |
| 483 | MW376550 | Neofusicoccum mangroviorum strain Yeh 0069 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence. | 559 | 99.8% | 544.0 | 0.00e+00 | 99.1% |
| 484 | MT587491 | Neofusicoccum mangroviorum culture CBS:111492 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 559 | 99.8% | 544.0 | 0.00e+00 | 99.1% |
| 485 | OR963365 | Neofusicoccum luteum strain UMAF A1933 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 543.0 | 0.00e+00 | 99.1% |
| 486 | OR963579 | Neofusicoccum luteum strain UMAF A1969 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 543.0 | 0.00e+00 | 99.1% |
| 487 | OQ672362 | Neofusicoccum luteum isolate NF146 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 543.0 | 0.00e+00 | 99.1% |
| 488 | MT587494 | Neofusicoccum mangroviorum culture CPC:32482 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 557 | 99.5% | 542.0 | 0.00e+00 | 99.1% |
| 489 | MH141250 | Neofusicoccum luteum strain Y.H. Yeh V0209 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 557 | 99.5% | 542.0 | 0.00e+00 | 99.1% |
| 490 | OR963578 | Neofusicoccum australe strain UMAF A1968 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 541.0 | 0.00e+00 | 99.1% |
| 491 | OQ678130 | Neofusicoccum luteum isolate C9 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 556 | 99.3% | 541.0 | 0.00e+00 | 99.1% |
| 492 | MT587493 | Neofusicoccum mangroviorum culture CBS:140740 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 556 | 99.3% | 541.0 | 0.00e+00 | 99.1% |
| 493 | MT587492 | Neofusicoccum mangroviorum culture CBS:140739 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 555 | 99.1% | 540.0 | 0.00e+00 | 99.1% |
| 494 | KY053009 | Neofusicoccum luteum isolate PED15 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 555 | 99.1% | 540.0 | 0.00e+00 | 99.1% |
| 495 | DQ233607 | Botryosphaeria lutea strain UCD2098Te 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 554 | 98.9% | 540.0 | 0.00e+00 | 99.1% |
| 496 | OP861692 | Neofusicoccum australe isolate EGGMM13_2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 558 | 99.6% | 543.0 | 0.00e+00 | 98.9% |
| 497 | JF271763 | Neofusicoccum luteum strain UCR1177 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 560 | 100.0% | 543.0 | 0.00e+00 | 98.9% |
| 498 | MT587483 | Neofusicoccum luteum culture CBS:133502 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 543.0 | 0.00e+00 | 98.9% |
| 499 | OR963368 | Neofusicoccum luteum strain UMAF A1936 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 541.0 | 0.00e+00 | 98.9% |
| 500 | MW132038 | Neofusicoccum luteum strain 19LSAS008 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 560 | 100.0% | 541.0 | 0.00e+00 | 98.8% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the identity (%) of BLAST hits grouped by genus. Each data point shows the alignment identity between the query and matched reference sequence. The analyst may wish to use this to make a subjective genus-level identification for the sample.
Analyst evaluation
Taxa of interest
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
See the Database coverage section to see database coverage for taxa of interest.
Reference sequence source diversity
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Analyst evaluation
No candidate species to report on.
Database coverage of target taxa
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Analyst evaluation
Preliminary ID
Database coverage
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
Database coverage of Fungi
Flag 5.1B:
The reference data has some support for this taxon
Reasoning: The given locus for this taxon has limited representation in reference database (≤5 entries)
3 records
There are 3 sequences in the reference database for Fungi at the given locus ITS.
Database coverage of species in genus Fungi
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
- Species in the genus Fungi
- At the target locus ITS
Number of GenBank records at locus ITS
Database coverage of species in genus Fungi that occur in country of origin
Flag 5.3C:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: No species in genus have been observed in the country of origin
/ (%) sequence records were found in the reference database for:
- Species in the genus Fungi
- At the target locus ITS
- In the sample country of origin Australia
Number of GenBank records at locus ITS
Intraspecies diversity
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
Analyst evaluation
Taxonomy Check
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |